single guide rna  (Synthego Inc)

Journal: Oncoimmunology

Article Title: ProS1-MerTK signaling in CD4 T cells: implications for TIL expansion and functionality

doi: 10.1080/2162402X.2025.2532662

Figure Lengend Snippet: TCR-mediated activation induces ProS1-MerTK signaling in human CD4 T cells. Naïve CD4 T cells were isolated from peripheral blood mononuclear cells (PBMCs) and stimulated with anti-CD3/CD28 beads. (a) Representative dot plots of flow cytometric analysis of ProS1 binding (left) and MerTK expression (right) in unstimulated and stimulated cells on day 3 post-activation. Gates were established using a fluorescence minus one (FMO) control. (b) ProS1 binding and MerTK expression levels measured by flow cytometry on day 3 ( n = 6). (c) Representative western blot showing MerTK protein levels on day 3 (left) and quantified protein levels (right) ( n = 3). (d) MerTK and ProS1 mRNA levels on day 5 post-activation, measured by qPCR ( n = 4). (e) ProS1 levels in culture supernatants over 8 days, measured by ELISA ( n = 3). (f) ProS1 binding and (g) MerTK expression over 7 days post-activation, measured by flow cytometry ( n = 3). Data are presented as mean ± SD. Statistical significance was determined by two-way ANOVA (b,d,f,g) or Student’s t -test (c,e).

Article Snippet: MerTK single chimeric guide RNA (sequence: AAAGGGCTGACCGTGTCCAA) and scrambled negative control guide RNA (mock) (both Synthego) ribonucleoprotein (RNP)s were introduced using the BTX ECM830 electroporation system (2 ms, 250 V, 1 pulse).

Techniques: Activation Assay, Isolation, Binding Assay, Expressing, Fluorescence, Control, Flow Cytometry, Western Blot, Enzyme-linked Immunosorbent Assay

Journal: Oncoimmunology

Article Title: ProS1-MerTK signaling in CD4 T cells: implications for TIL expansion and functionality

doi: 10.1080/2162402X.2025.2532662

Figure Lengend Snippet: ProS1-MerTK signaling improves central memory formation and T cell metabolism. (a) Representative flow cytometry gating strategy for memory subsets in unstimulated (black) and stimulated (blue) naïve human CD4 T cells 5 days post activation. (b) Timeline of memory subset percentages in human CD4 T cells following CD3/CD28 activation ( n = 3). (c) Average percentage of memory subsets on day 3 post-activation ( n = 6). (d) ProS1 binding and MerTK expression on memory subsets, measured by flow cytometry on day 5 post-activation ( n = 6). (e) Percentages of memory subsets with or without ProS1 stimulation measured by flow cytometry on day 5 post-activation ( n = 6) (f) Memory subset percentages in MerTK-negative or MerTK-positive cells, 5 days post-activation ( n = 9). (g) Percentages of memory subsets in primary MerTK-knockout (KO) cells after 5 days post-activation ( n = 3). (h) Average OCR following treatment with A) oligomycin (downward) or FCCP (upward) or B) antimycin a treatment measured using seahorse assay in primary MerTK knockout cells ( n = 3). (i) Detailed analysis of basal respiration, maximal respiration (OCR decrease after antimycin a injection), and spare respiratory capacity (SRC, difference between maximal and basal respiration) of data in (H) ( n = 3). Data are presented as mean ± SD. Boxplots show median ± SD. Statistical significance was determined by two-way ANOVA (e,f,g) or Student’s t -test (d,i). CM= Central Memory; EM = Effector Memory; temra = terminally differentiated effector memory; KO = Knockout, OCR = oxygen consumption rate.

Article Snippet: MerTK single chimeric guide RNA (sequence: AAAGGGCTGACCGTGTCCAA) and scrambled negative control guide RNA (mock) (both Synthego) ribonucleoprotein (RNP)s were introduced using the BTX ECM830 electroporation system (2 ms, 250 V, 1 pulse).

Techniques: Flow Cytometry, Activation Assay, Binding Assay, Expressing, Knock-Out, Injection

Journal: Oncoimmunology

Article Title: ProS1-MerTK signaling in CD4 T cells: implications for TIL expansion and functionality

doi: 10.1080/2162402X.2025.2532662

Figure Lengend Snippet: Proliferative and cytotoxic capacity is enhanced by ProS1-MerTK signaling. Data is collected after 5 days of activation or cell treatment. (a) Representative flow cytometry histogram showing CellTrace violet (CTV) staining and cell generations post-activation of human naïve CD4 T cells. (b) T cell proliferation on day 5, measured by flow cytometry ( n = 7). (c) Percentage of cells in specific cell generations on day 5 post-activation ( n = 6). (d) Percentage of proliferated cells in MerTK- negative or MerTK-positive cells and in ProS1-bound and unbound cells ( n = 3). (e) Intracellular cytokine staining for IFN-γ and TNF-α in MerTK-negative or MerTK-positive cells ( n = 5). (f) Absolute cell counts of mock-treated versus MerTK-knockout (KO) cells in total CD4 T cells over 14 days ( n = 3). (g) Intracellular cytokine staining for IFN-γ and TNF-α in mock-treated versus MerTK sorted KO cells ( n = 3). Data are presented as mean ± SD. Boxplots show median ± SD. Statistical significance was determined by Student’s t -test (b,d,e,g) or two-way ANOVA (c,f).

Article Snippet: MerTK single chimeric guide RNA (sequence: AAAGGGCTGACCGTGTCCAA) and scrambled negative control guide RNA (mock) (both Synthego) ribonucleoprotein (RNP)s were introduced using the BTX ECM830 electroporation system (2 ms, 250 V, 1 pulse).

Techniques: Activation Assay, Flow Cytometry, Staining, Knock-Out

Journal: Oncoimmunology

Article Title: ProS1-MerTK signaling in CD4 T cells: implications for TIL expansion and functionality

doi: 10.1080/2162402X.2025.2532662

Figure Lengend Snippet: ProS1-MerTK axis impacts type 1 helper polarization. All data were collected on day 5 post-activation or polarization. (a) Validation of T helper polarization by intracellular staining, showing relative mean fluorescent intensity (MFI) compared to Th0 ( n = 6). (b) Representative western blot (left) and quantified MerTK expression (right) ( n = 4). (c,d) MerTK expression (c) and ProS1 binding (d) on Th1 and Th2 subset measured by flow cytometry ( n = 6). (e,f) Relative MFI to Th0 cells of intracellular markers with ProS1 stimulation alone (e) ( n = 9) or during Th1 polarisation (f) ( n = 6). (g) Intracellular staining for Tbet and Gata3 in MerTK-negative or MerTK-positive cells ( n = 9) (h) intracellular staining for Tbet and Gata3 in primary mock-treated vs MerTK-knockout (KO) cells ( n = 4). Data are presented as mean ± SD. Boxplots show median ± SD. Statistical significance was determined by two-way ANOVA (a, c-f) or Student’s t -test (b,g,h).

Article Snippet: MerTK single chimeric guide RNA (sequence: AAAGGGCTGACCGTGTCCAA) and scrambled negative control guide RNA (mock) (both Synthego) ribonucleoprotein (RNP)s were introduced using the BTX ECM830 electroporation system (2 ms, 250 V, 1 pulse).

Techniques: Activation Assay, Biomarker Discovery, Staining, Western Blot, Expressing, Binding Assay, Flow Cytometry, Knock-Out